Skip to content
M2TOOLKIT

Popular tools

Menu

DNA Complement and Transcription Tool

Paste a DNA sequence to get its complement, reverse complement, mRNA, protein and GC content.

  • Free
  • No sign-up
  • Nothing is sent or stored

Spaces, numbers and line breaks are ignored. Use A, T, G, C (and N for unknown).

Result

Reverse complement (5′ → 3′)
TCAGCGGCCCATTACAATGGCCAT
Complement (3′ → 5′)
TACCGGTAACATTACCCGGCGACT
mRNA transcript
AUGGCCAUUGUAAUGGGCCGCUGA
Protein (frame 1, * = stop)
MAIVMGR*
Length
24 bp
GC content
54.17%

The calculation happens instantly in your browser. The numbers you enter are not sent to our servers or saved.

How to use the DNA Complement & Transcription Tool

  1. Paste the DNA sequence (5′ to 3′). Spaces and numbers are ignored.
  2. Read the reverse complement and complement.
  3. Check the mRNA, protein translation and GC content.

What does this tool do?

DNA bases pair A with T and G with C. The reverse complement is the sequence of the opposite strand read in its own 5′ to 3′ direction — what you need for designing primers.

Transcription swaps T for U to make mRNA, and translation reads it three bases (one codon) at a time using the standard genetic code. * marks a stop codon.

Why use it?

  • Five results at once.
  • Standard genetic code translation.
  • Handles long sequences.

Privacy

The calculation happens instantly in your browser. The numbers you enter are not sent to our servers or saved. There's no account to create and nothing to install.

Last reviewed by the M2Toolkit team.

Other tools people use alongside the dna complement & transcription tool.